2018-10-10 17:09:232025-05-11 09:31:48
locus
BSU04580
BSU_04580
geneLength
1533
1536
outlinks
bsu
BSU04580
BSU_04580
The protein
Catalyzed reaction/ biological activity
RNA helicase
required for [SW|ribosome] assembly (biogenesis of the large subunit) [Pubmed|23175651]
unwind duplex RNA with or without overhangs [pubmed|28238534]
RNA helicase
required for [SW|ribosome] assembly (biogenesis of the large subunit) [Pubmed|23175651]
unwind duplex RNA with or without overhangs [pubmed|28238534]
ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
The protein
Protein family
helicase C-terminal domain (according to Swiss-Prot) [SW|DEAD-box RNA helicases]
[SW|helicase family] (according to UniProt)
[SW|DEAD-box RNA helicases] (according to UniProt)
The protein
[SW|Localization]
cytoplasma, colocalizes with the ribosomes [Pubmed|16352840,27708634], cell membrane [Pubmed|20572937]
cytoplasma, colocalizes with the ribosomes [Pubmed|16352840,27708634], may also associate with the cell membrane [Pubmed|20572937]
Biological materials
Mutant
GP1035 (Δ[[gene|cshA]]::aphA3), available in [SW|Jörg Stülke]'s lab
GP1083 (Δ[[gene|cshA]]::cat), available in [SW|Jörg Stülke]'s lab
BKE04580 (Δ[[gene|cshA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
BKK04580 (Δ[[gene|cshA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
GP1035 (Δ[[gene|cshA]]::aphA3), available in [SW|Jörg Stülke]'s lab [pubmed|23175651]
GP1083 (Δ[[gene|cshA]]::cat), available in [SW|Jörg Stülke]'s lab
BKE04580 (Δ[[gene|cshA]]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
BKK04580 (Δ[[gene|cshA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTATAAAACTGCCCTTT, downstream forward: _UP4_TAATTTGATCGATTCAGAGC
Biological materials
Expression vector
for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1387, available in [SW|Jörg Stülke]'s lab
for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1026 (aphA3), available in [SW|Jörg Stülke]'s lab
for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1386, available in [SW|Jörg Stülke]'s lab
Labs working on this gene/protein
[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]
References
Original publications
The protein
[SW|Domains]
[SW|Helicase ATP-binding domain] (aa 34-204) (according to UniProt)
[SW|Helicase C-terminal domain] (aa 215-375) (according to UniProt)
Biological materials
Expression vectors
for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], in [SW|pGP382]: pGP1387, available in [SW|Jörg Stülke]'s lab
for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1026 (aphA3), available in [SW|Jörg Stülke]'s lab
for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1386, available in [SW|Jörg Stülke]'s lab
labs
[SW|Mohamed Marahiel], Marburg University, Germany [http://www.uni-marburg.de/fb15/fachgebiete/bio/marahiel?language_sync=1 homepage]